ID: 1125937546_1125937555

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1125937546 1125937555
Species Human (GRCh38) Human (GRCh38)
Location 15:43649424-43649446 15:43649471-43649493
Sequence CCCGGGAGCTGGAGGTGCCTCGC TCGGCCCAAGGAAAACCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 228} {0: 2, 1: 0, 2: 0, 3: 0, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!