ID: 1125939074_1125939076

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1125939074 1125939076
Species Human (GRCh38) Human (GRCh38)
Location 15:43662707-43662729 15:43662735-43662757
Sequence CCTTCAATTTATGGTTTACAGAG CAAGCTCTCCCACCTTAGTGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 247} {0: 2, 1: 0, 2: 0, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!