|
Left Crispr |
Right Crispr |
| Crispr ID |
1125942736 |
1125942737 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:43690406-43690428
|
15:43690424-43690446
|
| Sequence |
CCAATAAATAAAGGTTGAAAATT |
AAATTTTAACAGATGTAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 0, 2: 6, 3: 50, 4: 615} |
{0: 2, 1: 0, 2: 6, 3: 64, 4: 611} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|