|
Left Crispr |
Right Crispr |
Crispr ID |
1125952021 |
1125952023 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:43760312-43760334
|
15:43760333-43760355
|
Sequence |
CCCTGGGAGGTCGAGGCTGCAGT |
GTGAGCAATGATCATGCCGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 45, 1: 461, 2: 1885, 3: 3331, 4: 4635} |
{0: 1, 1: 4, 2: 55, 3: 268, 4: 805} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|