|
Left Crispr |
Right Crispr |
| Crispr ID |
1125952022 |
1125952023 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:43760313-43760335
|
15:43760333-43760355
|
| Sequence |
CCTGGGAGGTCGAGGCTGCAGTG |
GTGAGCAATGATCATGCCGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1481, 1: 12235, 2: 68564, 3: 191636, 4: 253953} |
{0: 1, 1: 4, 2: 55, 3: 268, 4: 805} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|