|
Left Crispr |
Right Crispr |
| Crispr ID |
1126010184 |
1126010189 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:44295168-44295190
|
15:44295201-44295223
|
| Sequence |
CCGCCGGGCTGAAGTGATTCTCC |
TCCTGAGTAGCTGAGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 28, 2: 749, 3: 4198, 4: 8650} |
{0: 2329, 1: 50429, 2: 170412, 3: 224564, 4: 204159} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|