ID: 1126012747_1126012751

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1126012747 1126012751
Species Human (GRCh38) Human (GRCh38)
Location 15:44318846-44318868 15:44318869-44318891
Sequence CCATATTTCTTACCAGTTCTCCC TAATTCTCTGTTGCAGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 345} {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!