ID: 1126020338_1126020342

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1126020338 1126020342
Species Human (GRCh38) Human (GRCh38)
Location 15:44394283-44394305 15:44394306-44394328
Sequence CCACGGAATACATTGCATCACAA CAGGGGATACATTCTGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 91} {0: 1, 1: 0, 2: 6, 3: 33, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!