ID: 1126037189_1126037194

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1126037189 1126037194
Species Human (GRCh38) Human (GRCh38)
Location 15:44557673-44557695 15:44557698-44557720
Sequence CCCTCTGGGTAGATTTTTAGTAG TGTTCTCTTCAGGAGGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 209} {0: 1, 1: 0, 2: 1, 3: 24, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!