ID: 1126049505_1126049515

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1126049505 1126049515
Species Human (GRCh38) Human (GRCh38)
Location 15:44673464-44673486 15:44673508-44673530
Sequence CCTTTTCCCCTCAAGAACTTCAC AGTCCCTCAAGGCAGCTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 237} {0: 1, 1: 0, 2: 1, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!