ID: 1126056670_1126056674

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1126056670 1126056674
Species Human (GRCh38) Human (GRCh38)
Location 15:44736227-44736249 15:44736248-44736270
Sequence CCACTCAGCTGGTGTCTTGATGG GGTGTGATGGGATCATGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 157} {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!