ID: 1126095565_1126095571

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1126095565 1126095571
Species Human (GRCh38) Human (GRCh38)
Location 15:45087274-45087296 15:45087326-45087348
Sequence CCTCTTCTGAGTCCTGATGAGGT GTGTTGTTTCCATATCACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!