ID: 1126105448_1126105454

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1126105448 1126105454
Species Human (GRCh38) Human (GRCh38)
Location 15:45144155-45144177 15:45144202-45144224
Sequence CCACAGAAGGTCAACTTCGTCCT TCTGCTGCTCAAGATCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 84} {0: 1, 1: 0, 2: 2, 3: 30, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!