ID: 1126105450_1126105459

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1126105450 1126105459
Species Human (GRCh38) Human (GRCh38)
Location 15:45144175-45144197 15:45144219-45144241
Sequence CCTGTCCAGCAACCGTGGACGCC CCAAGGAGTATGACCTGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 1, 2: 0, 3: 7, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!