ID: 1126109419_1126109425

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1126109419 1126109425
Species Human (GRCh38) Human (GRCh38)
Location 15:45166958-45166980 15:45166983-45167005
Sequence CCTCCGCCGGCGCGCGGCTTCCG TGGCAGGCCGCCCCGCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!