ID: 1126112444_1126112455

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1126112444 1126112455
Species Human (GRCh38) Human (GRCh38)
Location 15:45183652-45183674 15:45183685-45183707
Sequence CCAGTAGCTCCCACCCATGGTCC AGCTGTTCCTGGCTCCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203} {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!