ID: 1126140095_1126140099

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1126140095 1126140099
Species Human (GRCh38) Human (GRCh38)
Location 15:45430412-45430434 15:45430440-45430462
Sequence CCAGCGCCCGCGTTCGGGCGCTT CAGCCGCAGAATGTCCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67} {0: 1, 1: 0, 2: 0, 3: 17, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!