ID: 1126140155_1126140167

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1126140155 1126140167
Species Human (GRCh38) Human (GRCh38)
Location 15:45430644-45430666 15:45430694-45430716
Sequence CCCGGCGTCCAGGTGAGTCTCCC CGCAGTTGGCCTGCGGAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162} {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!