|
Left Crispr |
Right Crispr |
Crispr ID |
1126140992 |
1126140995 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:45438556-45438578
|
15:45438572-45438594
|
Sequence |
CCTGTCTCTACAAAAAATAAAAA |
ATAAAAAAATTAGCTGGGTGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1205, 1: 14690, 2: 212366, 3: 268082, 4: 182877} |
{0: 386, 1: 23583, 2: 61864, 3: 128471, 4: 163302} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|