ID: 1126140992_1126140996

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1126140992 1126140996
Species Human (GRCh38) Human (GRCh38)
Location 15:45438556-45438578 15:45438588-45438610
Sequence CCTGTCTCTACAAAAAATAAAAA GGTGTGGTGACGCATGCCTGTGG
Strand - +
Off-target summary {0: 1205, 1: 14690, 2: 212366, 3: 268082, 4: 182877} {0: 4, 1: 149, 2: 1109, 3: 3008, 4: 6521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!