ID: 1126158534_1126158540

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1126158534 1126158540
Species Human (GRCh38) Human (GRCh38)
Location 15:45587430-45587452 15:45587453-45587475
Sequence CCAGCTGGAGGGACATGAGTGTC CCTGGGCCGTCGTCTCCGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119} {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!