ID: 1126163500_1126163505

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1126163500 1126163505
Species Human (GRCh38) Human (GRCh38)
Location 15:45634890-45634912 15:45634905-45634927
Sequence CCCTGGTGTGTTCACTGACCATG TGACCATGGTGCCTGGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154} {0: 1, 1: 0, 2: 6, 3: 40, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!