ID: 1126163500_1126163512

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1126163500 1126163512
Species Human (GRCh38) Human (GRCh38)
Location 15:45634890-45634912 15:45634917-45634939
Sequence CCCTGGTGTGTTCACTGACCATG CTGGGCTGCGGCGCCGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154} {0: 1, 1: 0, 2: 3, 3: 64, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!