ID: 1126163501_1126163507

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1126163501 1126163507
Species Human (GRCh38) Human (GRCh38)
Location 15:45634891-45634913 15:45634911-45634933
Sequence CCTGGTGTGTTCACTGACCATGG TGGTGCCTGGGCTGCGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 130} {0: 1, 1: 0, 2: 2, 3: 20, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!