ID: 1126172927_1126172933

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1126172927 1126172933
Species Human (GRCh38) Human (GRCh38)
Location 15:45709085-45709107 15:45709125-45709147
Sequence CCCTCAGCTGGAATCAGCTTGTG AGAGCCCCCAGAGACATCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!