ID: 1126206644_1126206650

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1126206644 1126206650
Species Human (GRCh38) Human (GRCh38)
Location 15:46053215-46053237 15:46053240-46053262
Sequence CCTGGCTCAGTGATCAGCTGGGG AAAGCTTCTTGGAGGGATATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 14, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!