ID: 1126286666_1126286668

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1126286666 1126286668
Species Human (GRCh38) Human (GRCh38)
Location 15:47020244-47020266 15:47020290-47020312
Sequence CCTGTGAAACACTATCAAATATG CAGATGGAGAAAAAAAGAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 21, 3: 251, 4: 2425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!