ID: 1126310364_1126310369

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1126310364 1126310369
Species Human (GRCh38) Human (GRCh38)
Location 15:47309157-47309179 15:47309203-47309225
Sequence CCATCAGTGGTTTTGCTTTTCAC CACCATTTGGAAATATTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 338} {0: 1, 1: 0, 2: 6, 3: 42, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!