ID: 1126325851_1126325855

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1126325851 1126325855
Species Human (GRCh38) Human (GRCh38)
Location 15:47476577-47476599 15:47476614-47476636
Sequence CCTTCCTCATGCTCTATCTCCTT AATTGTTTAGAGACAAACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 856} {0: 1, 1: 0, 2: 1, 3: 18, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!