|
Left Crispr |
Right Crispr |
Crispr ID |
1126325851 |
1126325864 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:47476577-47476599
|
15:47476629-47476651
|
Sequence |
CCTTCCTCATGCTCTATCTCCTT |
AACACTGGGAATGGGGGTGGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 6, 3: 67, 4: 856} |
{0: 1, 1: 0, 2: 12, 3: 95, 4: 714} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|