ID: 1126326112_1126326116

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1126326112 1126326116
Species Human (GRCh38) Human (GRCh38)
Location 15:47479333-47479355 15:47479355-47479377
Sequence CCATCCTCAACCTGTTTCTCTAT TGCTAAGTTCAGTAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 54, 4: 526} {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!