ID: 1126336512_1126336515

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1126336512 1126336515
Species Human (GRCh38) Human (GRCh38)
Location 15:47591126-47591148 15:47591149-47591171
Sequence CCTGCTTCATAAATGGCACTTTG TTGCTGCATCCTCATGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 368} {0: 1, 1: 0, 2: 1, 3: 33, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!