ID: 1126341156_1126341163

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1126341156 1126341163
Species Human (GRCh38) Human (GRCh38)
Location 15:47642529-47642551 15:47642574-47642596
Sequence CCCTCAAAGGCTTCACTGTCTAG CATCTAGATAGGAGCAATGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 58, 4: 373} {0: 1, 1: 0, 2: 0, 3: 13, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!