ID: 1126341498_1126341499

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1126341498 1126341499
Species Human (GRCh38) Human (GRCh38)
Location 15:47645766-47645788 15:47645782-47645804
Sequence CCAGCTATACATTGGGATTCCCA ATTCCCACAACTCCCTCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 20, 3: 53, 4: 162} {0: 2, 1: 9, 2: 46, 3: 111, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!