ID: 1126351047_1126351055

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1126351047 1126351055
Species Human (GRCh38) Human (GRCh38)
Location 15:47745159-47745181 15:47745198-47745220
Sequence CCACACACCCTTCCTCACAGTTG CAGGCTTCCTGGTACTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 316} {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!