ID: 1126412924_1126412928

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1126412924 1126412928
Species Human (GRCh38) Human (GRCh38)
Location 15:48390584-48390606 15:48390598-48390620
Sequence CCTACTCTTCCTGTCTTGAGTCC CTTGAGTCCTGGCCCTGGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 32, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!