ID: 1126422522_1126422529

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1126422522 1126422529
Species Human (GRCh38) Human (GRCh38)
Location 15:48489950-48489972 15:48489975-48489997
Sequence CCTCGCATTCCTCAGTACCCCAG TGCCCCGACGGAGCAGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 120} {0: 1, 1: 0, 2: 3, 3: 14, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!