ID: 1126422522_1126422533

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1126422522 1126422533
Species Human (GRCh38) Human (GRCh38)
Location 15:48489950-48489972 15:48489986-48490008
Sequence CCTCGCATTCCTCAGTACCCCAG AGCAGCAGCAGGCGTCCATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 120} {0: 1, 1: 0, 2: 2, 3: 11, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!