ID: 1126422532_1126422538

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1126422532 1126422538
Species Human (GRCh38) Human (GRCh38)
Location 15:48489979-48490001 15:48490007-48490029
Sequence CCGACGGAGCAGCAGCAGGCGTC GGTGGCGGCCAGCAATAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 98} {0: 1, 1: 0, 2: 0, 3: 16, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!