ID: 1126427322_1126427334

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1126427322 1126427334
Species Human (GRCh38) Human (GRCh38)
Location 15:48542673-48542695 15:48542697-48542719
Sequence CCCCCAGTTTTCCCCATGGAACC GATTCAGTAGATGTGGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 196} {0: 1, 1: 1, 2: 25, 3: 151, 4: 736}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!