ID: 1126431880_1126431883

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1126431880 1126431883
Species Human (GRCh38) Human (GRCh38)
Location 15:48594474-48594496 15:48594496-48594518
Sequence CCCTTTTTCCTGAAGGGGAGCAG GTTGAAGACACCCCCAAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 204} {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!