ID: 1126432566_1126432572

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1126432566 1126432572
Species Human (GRCh38) Human (GRCh38)
Location 15:48601836-48601858 15:48601885-48601907
Sequence CCACACACTGAAACACCATCAAA CCTCCATCTCTCCACATTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 360} {0: 1, 1: 1, 2: 8, 3: 23, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!