ID: 1126456876_1126456879

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1126456876 1126456879
Species Human (GRCh38) Human (GRCh38)
Location 15:48872475-48872497 15:48872488-48872510
Sequence CCATTAAAAACTATGTAAGCCCA TGTAAGCCCAAAGCTTCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 200} {0: 1, 1: 0, 2: 0, 3: 30, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!