ID: 1126458214_1126458215

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1126458214 1126458215
Species Human (GRCh38) Human (GRCh38)
Location 15:48887722-48887744 15:48887746-48887768
Sequence CCAAAAGATCGACAAAACTGACA ACCTTTAGCTAGATGAACTAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 14, 4: 139} {0: 1, 1: 2, 2: 7, 3: 42, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!