|
Left Crispr |
Right Crispr |
| Crispr ID |
1126460805 |
1126460807 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:48913300-48913322
|
15:48913314-48913336
|
| Sequence |
CCAGGTCACTGGAGCTGTGTACC |
CTGTGTACCTAGAAGGATTATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 113, 2: 154, 3: 112, 4: 218} |
{0: 2, 1: 16, 2: 172, 3: 176, 4: 228} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|