ID: 1126482564_1126482572

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1126482564 1126482572
Species Human (GRCh38) Human (GRCh38)
Location 15:49142352-49142374 15:49142399-49142421
Sequence CCATGGAGTGCCCCTCCTATTAA GACAGTACCTCAAAAAGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 64} {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!