ID: 1126518829_1126518835

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1126518829 1126518835
Species Human (GRCh38) Human (GRCh38)
Location 15:49565675-49565697 15:49565725-49565747
Sequence CCCTGGAACCTGTAAATGTTACC TGATAGTTAAAGATCTTCGGTGG
Strand - +
Off-target summary {0: 15, 1: 81, 2: 218, 3: 433, 4: 824} {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!