ID: 1126523643_1126523644

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1126523643 1126523644
Species Human (GRCh38) Human (GRCh38)
Location 15:49624808-49624830 15:49624829-49624851
Sequence CCTGTCTGATGCTAACGTGAAAC ACCATTGCATTCCTAATATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54} {0: 1, 1: 0, 2: 2, 3: 12, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!