ID: 1126524520_1126524521

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1126524520 1126524521
Species Human (GRCh38) Human (GRCh38)
Location 15:49636108-49636130 15:49636160-49636182
Sequence CCTTTTTTTGGTTTGGCTTTCTC TTGTTGTAGCATGTATCAATAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 7, 3: 65, 4: 696} {0: 1, 1: 1, 2: 5, 3: 30, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!