ID: 1126525864_1126525865

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1126525864 1126525865
Species Human (GRCh38) Human (GRCh38)
Location 15:49653401-49653423 15:49653439-49653461
Sequence CCAGAAAGGAATGCAGTTCAGCT GATCAGTGAGATTTTTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 62, 4: 366} {0: 1, 1: 0, 2: 1, 3: 28, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!